Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig5
Contig Information
Length 703 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhfl18j20   
Homology (BLAST) Top Hit hypothetical protein OsJ_000428 [Oryza sativa (japonica cultivar-group)]
Score 189
Evalue 9.35115e-13
Total Hit Count 185
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig5
tttgatggaatgtagaaactgcaaaatgattccatgtgcacatagtacaacagatattatggtctgactggagtgtcaataccgaaatagagtacacgat
aaaatcaaactcgtacaggcaagtcttttgttcaacatgtttggagagtttcataactgtaggaagaatatgatccatctctcgaccctcaccaggtgat
gctcttccactgggtgaacactggaaggattttgatccataactcaacctccaccaggtgaggcacttccactgggtgcgcggtggttgccattgtcttc
accatccctggggctcgggctacgaccatttgcagctgggctcatgttattagggctgtcagccttcattgggctcctgctgttttcccttggtgcaggg
ctcctgctgccaggaggggtggggctccgggccctccccttgacaggtgaagcgctcctcctagggctgcggctgtcacgggggctcctcatagggctgc
gactgtctcgggggctcctccttgggctgcgactgtcacgggggctcctccttgggctgcgactgtcacggggactccttgatcgtctttcatccctcct
tggggaaacagagcggctgtagctcctactgcggctcctgctgtagctcctatcacgcacccttccgcggcgaggagatggagatctggagtaactcttt
cca
page-top