Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig859
Contig Information
Length 668 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd12i05    rwhvd12i05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit homeobox-like resistance [Triticum aestivum] >gi|167882868|gb|ACA06113.1| homeobox-like resistance protein [Triticum aestivum]
Score 673
Evalue 6.32179e-69
Total Hit Count 30
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig859
CTTCCTGGGGATCTCATTCTTTGTTTTCAGGAAGGCAAAGAGCAGGCCCTCTATTTTGACGCTCGTGTTCTTGATGCTCAAAGGCGCAGGCATGATGTAA
GAGGGTGCCGCTGCAGGTTTCTTGTTCGTTATGATCATGATCACTCTGAGGAGATTGTTCCTCTGAGGAAGGTATGCCGTCGACCAGAAACTGATTTCAG
GCTCCAGATCTTGCACGCATCTAGAGCGGCGGCCTCTGCGGATGCTCAGAATGTTAGCCCAGTTGAGCAGAAACCCCAAAAGGCGCACAAGATGATGGAT
GTGAACACTGCCGAGGTGACCGTGGTTCGCAACCCAGATCAAGGAGGGCCATCTGACAAGCCGGCTGCTCCCTTACCAGCTGCGCCTGCTGGCACCCACG
GTGATTCAGTTTCAGATGTGCAGATGGGGAATGTGGAGGTTATTCCAAAAGTTGAAGCTGCAAATGAAGCACATGATGACAACATGAACGTGGGAGCGTA
GTTGTTTCGCTTCCCTGTGCGCTTCGGTGTGTACTTACTAAGTCCAAAAAAATGTTTGCTTAGGAACTTCCGGTCGAGGAAGGATGGTCGCCCGGTAACT
GTAATGTGCCGATGTCGACTTGTTTGCTGATGTGTGTACAAAGTCTTGGATTGTCGGTAAAAAAAAAA
page-top