Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1451
Contig Information
Length 673 bp
Tissue Callus
Clones 3 Clones [Download: CSV  ,  FASTA ]
whcs10c10    whcs16n11    rwhcs10c10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_31924 [Oryza sativa Indica Group]
Score 637
Evalue 9.65203e-65
Total Hit Count 432
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1451
CATCTCCGCCGCCGCCGCCGCCGCTCGCCTTGCAAGATGGCGGTGCCTATCCTGAAGACGGCGATCGTGAAGAAGCGGGTGAAGCACTTCAAGAGGGCGC
ACAGCGACCGCTACATCGGCCTCAAGCAAAGCTGGCGCAGGCCAAAGGGTATCGACTCCCGCGTCAGGCGGAAGTTCAAGGGATGCACCTTGATGCCCAA
CATTGGATATGGTTCTAACAAGAAGACGAGGCACTACCTGCCCAACAAGTTCAAGAAGTTTGTGGTTCACAACGTCTCTGAGCTGGAGCTGCTTATGATG
CACAACAGGACGTACTGTGCTGAGATCGCGCACAACGTGTCCACCCAGAAGCGCAAGGCGATAGTGGAGCGTGCCGCCCAGCTCGACGTCGTGGTCACCA
ACAAGCTCGCCAGGCTCCGCAGCCAGGAGGATGAGTGAAATGTTTCAAACAGTAGCGCTTTTGGATCATTTTGTTCCGTTCCCTGTAGTAGACTTAATGC
CGAATCTGGAGTTTTCTTCTCTGTTCGCCTTGTTGATTCGACGCTGTTGAACACCTTTATCGATGCTGGTCATGCTCTCGTACTATAAGCACCATTGACT
TTGACGTGAAGTCCGGGTTGCCTTTAATCATCAGCTATGGAAAGATTTTCTGGGCCGCTTTTCAAAAAAAAAA
page-top