Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig726
Contig Information
Length 579 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd10c09    rwhvd10c09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_31808 [Oryza sativa Indica Group]
Score 388
Evalue 5.0541e-36
Total Hit Count 24
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig726
GCTTGACAATAAACAGGATGCGGCTAATGCTGGTATATGGTATCTCTGCCGAATGGCAGGAGGTATAAAAGAGGGAATAAATGCCAAGTTTTTCCAAGAA
GCGGATGAAAAACTCAAGCTCTTGGACCTGGCTCATACTGAAAAGAAGCCGGTGAAGGGTCTGGAGTTATTTCTGGAGAGCACCAAGGAAGTCAAGGCAC
TCGACTCCAAGCCTAAGACCATCGTGCAGATTGATGCCAAGAAACCGATGAAGGCGTTCGACGTGCCTGTGAAGAGCGCTGCGGTGCACAGGTCAAACAG
GTTCTTAATTCGCAAGGAAGGCCTCGCACTGTGATGGACGCCTTCCCGTGCTGCTTGCGATGTACATTGCGTTCTTGCTTGATTTGTTTGGTAGAAAATA
TAGAAGAATAACCTGCATCCCGAGTGGTGATTTTCCAGGATAGACAGGTTGATACGTCTCAAGGCAATTTGTATTTGTTCCTTTGTATTTTTTGGGTCAT
TTCATGTTCTGGTCTGAAGTTGCTCGCTTGTAAACAAGTGAAGAAATAAATAATTAAAATACGTTTTGCAAAAAAAAAA
page-top