Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig710
Contig Information
Length 690 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd10c18    whvd10k24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hexose transporter [Hordeum vulgare subsp. vulgare]
Score 909
Evalue 6.83672e-103
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig710
AGATTCGGCGGCCATGTCGGGCGCCGTGCTGGTCGCCATAGCGGCGTCCATCGGGAACCTGCTGCAGGGGTGGGATAATCGCGACCATTCGCAGGTGCCG
TCCTGTACATAAAGAAGGAGTTCAGCTTGGAGACCCAGCCCTTGATCGAGGGCCTCATCGTGGCCATGTCGCTCATCGGGGCGACGGTTATCACCACGTT
CTCGGGGGCGGTGGCTGATGCTGTTGGCAGGCGGCCCCTGCTGATCGCCTCGTCTGTCCTCTACTTTGTCAGTGGCCTGGTGATGCTCTGGGCGCCCAAC
GTCTATGTGTTGCTCTTGGCCAGGCTCATCGACGGGTTCGGTATCGGTTTGGCTGTCACCCTTGTCCCTCTTTACATTTCGGAGACCGCCCCGACTGACA
TTAGAGGGCTGCTGAACACGCTGCCGCAGTTCAGTGGTTCAGGAGGGATGTTCCTTTCTTACTGCATGGTGTTCACCATGTCGCTCATGCCACAGCCTGA
CTGGAGAATCATGCTTGGGGTTTTGTCGATCCCGTCGCTTATGTACTTTGCATTGACTGTCTTCTATTTGCCCGANTCGCCNAGATGGCTTGTGANCAAA
GGAANAATGGCTGANGCCAANCNAGTGTTGCAAGGACTGCNGGGAANGGAANATGTCTCANGANAAATGGCCCTTCTTGTTNAANGATTG
page-top