Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1417
Contig Information
Length 683 bp
Tissue Callus
Clones 3 Clones [Download: CSV  ,  FASTA ]
whcs10e17    rwhcs10e17    rwhcs10n08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit retrotransposon protein, putative, Ty1-copia subclass [Oryza sativa (japonica cultivar-group)]
Score 663
Evalue 9.62477e-68
Total Hit Count 351
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1417
TTTTTTTTTTGTACCAGAATAGCATGCGATCTACTTCAACGAAGTCTTGGATAACAAACACAGGGGGGTATCATAATTCAAAACTGTAGCCAAATTCTAC
TACCGAACACGATTGCATAGAGGGGACTTCAACTGATCAGAATTCGGCAGGAACAGTTCCTGCAACCTGGTCCAGATCACGCCTTCCCTGGGAGGTGATG
AGCCTTCCACCCTTGGGGTCCACATCAATGATGCCCATCTTCTGCAACTCCTGGAGGATGTTGCGGGACACAGCACCACTGCTCTTGCAGAAGTGCGGTG
GGCGTGAACCATTCCTCTGACGGCCACCGTAGATCTTCTGGAAGCCGCCGATCCCAATTCCCTGCCTCAGGTAGATCTTCCTTGCCATCGAGGCAGCCCT
GATGTAGTACCAGTCAGCATCAGAAGGTGGAAGCTCCTTGAACCTTGCAGTCTTGACAATGTCAACCCACTCCGGAAGCTCCATCTTGCCGGAGCGCTTG
AGGTGCGCGGAGTAGGCCTTGACGAACTCGTGGGGGTTGACATCCTTCACCGTGCGCGCCGTGGAGGCCGCGGTCTCGGCTGCGGGAGCGGGCACGGTCG
CCATCCTGTGCTCTCGCCGACGGCGGCGCTGTCTTCAGGGAGGAGGGAGAGGTGTGCGCGCCGCTGCGGCTGCGAGGGCTAGG
page-top