Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig353
Contig Information
Length 703 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd15j11    rwhvd15j11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11005 [Oryza sativa Indica Group]
Score 580
Evalue 4.28375e-58
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig353
AGGGTTTTAGCCGCCGGCCATGGCCCTCTCCTCGTCTTCCTCCACCCTGCTCCGCCGCCTCCTCGGCTCCACCCCCCTTTCATCCTCCCGCTCCTCTGTA
CTTCGCGCCGCCTTCTGCTCCTCCTCCTCCGCGGCCCCCTCCCCCACCTTGCCTCCTCCTTCGACCATCTTCGGCGACGACACCGAGGTCGCCAACGTGC
CGCCGCTCACCACCCCCAAGCTCTTCGTCAGCGGGCTTTCAAGGCTAACGACGGATGAGAAGCTCAAGAGCGCGTTTGCTCCCTTCGGACAGCTTCTTGA
AGCGAAAGTCATAACAGATAGAGTTTCTGGGAGATCAAAGGGCTTTGGTTTTGTAAGGTACGCGAGTTTAGAAGAAGCTGAGACCGCGCGGCAGGAGATG
AATGCCAAGTTTCTGGATGGATGGGTCATTTTTGTCGACCCTGCAAAACAAAGGGAGCAGAAGCCTGCTCCTCAGCCGGATACTGCTTCCTCGCACGCTG
GCTTCACGATCAATAAAACTGTAGGATGGTGTGGTTAGTTGCTTAGGCTCTCGAGTCCTATAGATCACATAGCAATGGCATGGATGATGTTCTAGCCACA
GAAAGTTATGGCATTACTGCCTGTATTAATACATAAAACGATAACGCTGTTCCTCTTTTGAGATAATAATGTTGCTCTTTGTGGCTTCACACTAAAAAAA
AAA
page-top