Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig309
Contig Information
Length 801 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd10d12    rwhvd10d12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0568200 [Oryza sativa (japonica cultivar-group)] >gi|34393289|dbj|BAC83203.1| unknown protein [Oryza sativa Japonica Group] >gi|113611563|dbj|BAF21941.1| Os07g0568200 [Oryza sativa (japonica cultivar-group)]
Score 117
Evalue 1.32011e-07
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig309
GTTACAGTTTCCATTTTCCTTCTGATGGCGTCCGGGAGTGGTTCTCATTTTAGTGACCAAGCCATCGCTGTCAATGAATGGGCGCATGAGTAATAATCAG
TTTCAAATACTTCACAGCGCCCCCTCAAATAACTCCAGTGAAAAAGGGACTCTTGAATTGTTTGGGGCAGACAACTCTACTGATAAAGGAACTCGTGAAA
TTGTCTGGCATTCTGTAGATGGCATGAAAACGAGTAAGGAGTTACATGCGCAGCAATTTCATTGAATTGTTCAACCTTCACAGAATGAATTTGTTGCTGG
TTAAGAGAATTCCATGATCTTGTGGTAGAAAGCAAAACATCACAGATGCCAATCTGTCAAATTTCTGTTTTGGGTTAGGAGACGAATCGAGGAAGCTTAT
ACAGATAATTGTGAATTTCAGCTGTAGTTCGGTGCTTTTCCGGATGTTTGGGCTTGATTCTTGTCAAAAACATATGAGCCTGAACTAACATGTGATGGAT
GTTTGCCGTCATTCCTTTTGACACCAGAAATGAAGGGAAAAAAGATGAAAATGGCGAGTGCAAGAATCGTGCCCTCGTTGTTAGGATGCCATCTCATGAA
GCTTTTACTTCATTTTATTTATGTGGAGATTTTTCTGATGAGTTATACCCGTACTCTTTACCTTTTTTGCCTGTACTATGTGGAGTTTCTAGAAAACTGC
GTAATCGTGTGCCCATATAAGAACCATAGCTTAGCTGAACTTTGAAGTCTTGCCTTGTCCCGTAATTCAAAAGGAGAACGCAAAACAGATATGTTCATGC
A
page-top