Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1391
Contig Information
Length 1249 bp
Tissue Callus
Clones 3 Clones [Download: CSV  ,  FASTA ]
whcs7f04    whcs14m20    whcs1l23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative cellulose synthase catalytic subunit [Hordeum vulgare]
Score 2056
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1391
GCCTTCTTTTGTGAAGGAAAGACGAGCAATGAAGAGAGAGTATGAAGAATTTAAAATACGAATCAATGCACTTGTTGCCAAAGCCCAAAAAGTGCCTGAA
GAGGGGTGGACCATGGCTGATGGCACCGCTTGGCCTGGGAACAACCCTAGGGACCATCCTGGCATGATTCAGGTGTTCTTGGGGCACAGTGGTGGCCTTG
ACACTGATGGTAATGAGTTGCCACGGCTTGTGTATGTCTCTCGTGAAAAGAGGCCAGGTTTCCAGCATCACAAGAAGGCTGGTGCAATGAATGCATTGAT
TCGTGTGTCTGCCGTGTTGACAAATGGTGCCTATCTTCTTAATGTGGATTGTGATCACTACTTCAATAGCAGCAAAGCTCTTAGAGAAGCAATGTGCTTC
ATGATGGATCCCGCTCTAGGAAGGAAAACTTGCTATGTCCAATTTCCACAAAGATTTGATGGCATTGATTTGCACGATCGATATGCTAATCGCAACATTG
TTTTCTTTGATATCAACATGAAAGGTTTAGATGGCATTCAGGGTCCAATGTATGTCGGGACAGGATGCTGTTTCAACAGGCAGGCCTTGTATGGCTATGA
TCCTGTATTAACTGAGGCTGATTTGGAACCTAACATTGTTGTTAAGAGCTGCTGCGGTGGTAGAAAGAAAAAGAGCAAGAGCTATATGGATAACAAAAAC
CGAATGATGAAGAGAACCGAGTCTTCTGCTCCCATCTTCAACATGGATGATATAGAAGAGGGTATAGAAGGTTATGAGGATGAAAGGTCAATGCTTATGT
CCCAGAAGAGATTGGAGAAACGATTTGGTCAGTCTCCTATATTTACTGCATCCACCTTTATGACTCAAGGAGGCATACCACCTTCAACAAACCCAGCTTC
TCTACTAAAGGAAGCCATCCATGTCATCAGCTGTGGATACGAGGACAAGACCGAATGGGGAAAAGAGATTGGCTGGATCTATGGTTCAGTTACTGAAGAT
ATTCTTACTGGGTTTAAAATGCACGCAAGAGGGTGGATATCAATCTACTGCATGCCACCACGGCCTTGTTTCAAGGGTTCTGCGCCAATCAATCTGTCTG
ACCGTCTTAATCAAGTGCTCCGATGGGCCCTTGGGTCAGTTGAAATTCTGTTTAGCAGACATTGTCCTATCTGGTACAATTACGGTGGGCGGTTGAAACT
TCTGGAGAGGGTGGCTTACATCAACACCATTGTTTATCCATTAACATCC
page-top