Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig184
Contig Information
Length 776 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd14d16    rwhvd14d16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Dictyostelium discoideum AX4] >gi|74851784|sp|Q54FZ4|Y8927_DICDI RecName: Full=Putative uncharacterized protein DDB_G0290521; Flags: Precursor >gi|60463958|gb|EAL62121.1| hypothetical protein DDBDRAFT_0188927 [Dictyostelium discoideum AX4]
Score 153
Evalue 1.70136e-08
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig184
TACTACAAAGCAAGTGAGCTGAGTGAGCTGTGAGCAGCTAGCTAGTGATCGGCGACGATGAGGGCATCCGCCTTCTCGCTGTGCTTGCTGTTGGCCCTCG
TCGCGGCAAATGTTGCTAGCCTCGCCGTCGCTGGGAGGGCGCCGGAGCTGAAACATGAGCCCAGCCTAGAGCCGAAGCCTACGCCACAGCCTGACCCCAA
ACCAGACCCGCAGACCGACCCTAAACTCGCGCCGAAACCTGACCCGACACCCAAGCCCGACCCTAAACTCGCGCCAAAACCTGACCCAAAACCANACCCA
AAACCGGTGCCGAAACCTGACCCAGCACCCAAGCCCGACCCCAAACCGGCGCCGAAACCTGACCCAGCACCCAAACCCGACCCCAAACCAGACCCGCAGC
CCGACCCTAGACCGGCGCCAAAGCCTGACCCCAAGCCCACGCCCGACCCAAAGCCTGCCCCGGGCCCCAGCCCGAAGCCGGACCCCAAACCCCAGACGCC
GGAACAATCGTCCTCGCAGCCGAAGCAGCCGCCACGTTCGCCGTCAGGCTACTTCAACTGACGGGAGGGAGGCTCGTCAGCAGCCGCTTGGTAATGGAGA
ATTAGCCTGCCTGCATTTGCATGGGTGTTGGTGCTTAAGTTGTCTCCGGTAATGGTTAGTAATGTATTGCATGTGTTCCCTCCGTCTCTGTACGTGTTGT
CTCCAGTTTGTTCGTGTGAGCCATCTTTGCGTCAGTGTGTCTCCCGTGTGATGTACCATGAATAAACCAGAGGAAC
page-top