Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig170
Contig Information
Length 824 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd10e17    rwhvd10e17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit zeaxanthin epoxidase [Triticum aestivum]
Score 948
Evalue 1.23616e-100
Total Hit Count 234
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig170
ATGCCTTTGATGCTGAGCTGGATTTTAGGTGGCAACAGCTCAAAGCTGGAAGGAAGACCGTTAAGTTGCCGGCTTTCTGACAAGGCAAGCAACCAGCTTG
GTCGATGGTTTCAGGATGACGATGCATTGGAACAAGCTATGGGTGGAGAGTGGTACCTCTTCCCTATGAGCTCTGGAGGCGACTCTGCCTTGCAGCCCAT
TCGTTTGATCAGGGATGAACAGAGGACACTCTCTATTGGAAGCAAACCAGATCCGAGCAATTCTGATTCTTCGTTGTCGTTCCCCTTGCCACAAGTATCA
GAGATCCATGCTACTATCACATGCAAGAATAAGGGTTTCTATTTGACCGATCTGGGAAGCGAGCACGGTACATGGTTTAACGACAACGAAGGCAGACGCT
ACCGGTTACCTCCAAACTTCCCAGTTCGTTTCCACCCTTCCGATGCCATCGAATTTGGCTCAGACAAGAAGGCCATGTTCCGGGTGAAGGTGCTGAGCAC
GCTTCCGTACGACTCCGCGAGAGGAGGGGGAGAAGTTCTGCAGGCAGCATGAGTGGGGACTTCAACGACCCCTTGTCACCAGCCACTGTACAGCATTCTT
CAGTAAACAGCCGACACTGCATCATGGAAAGAAAAAGAATTGTAACTTTTGCACTCATCCAGATATCCAAAGCAGGATTTTGAGTAGCTTCTGACAGAAT
TACTACGTTGCAGTTCTACGAAAAAGAACCGAGGGTGTACAATAGGGTAGGCAATTTTTAGCTGTTGCCACTGTAATATTGTACCTAGTACAGTACATTG
TTGTGCCTATTAACACGTGTTCAT
page-top