Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig157
Contig Information
Length 1097 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd10h02    rwhvd10h02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1290
Evalue 4.35826e-140
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig157
GGCAACAGTTCCGTACCCATCCCCTCCACTGGTCAATCCCCATCCCCTGTTCCGTTCATACATCTACCTCCTCCGCCGCCGCCATGCCGCCGGCCGGCAG
CCTCACCGCCGAGCAGCTCAGCTTCTTCGAGAAGAACGGCTACCTGGTGCTGGAGTCGTTCTCGAGCGCGGAGGAGGTTCAGGCTATGCGGGGCCGCATG
GCCGAGCTCGTCCACGGCTTCGACGGCGCTGACTCCAGTGTCTTCTCCACTAAGGATCATCGGCAGTTGAAGGATGACTACTTCTTTAAGAGTGCGGAGA
ATATATCTTTCTTCTTCGAGGAAAAGGCATTTGGAGATGATGGATGCTTGAGACAGCCAAAGGAACTTTCAATCAATAAAGTTGGACATGCACTACATGA
ACATGACCCTGTGTTCAAAAAGTTTGCTTTCTCGGAGAGTATTTCTAGCCTGTTCTCTTCTTTAGGGTACAAGAGACCTGCAGTTATTCAATCTATGTAC
ATCTTTAAGCAACCGGGCATTGGTGGCGAGGTGGTGCCACACCAGGATAATACATTCCTTTATACAGAGCCCCTATCATGCACAGGATTGTGGCTAGCAC
TTGAAGATGCAACAATTACAAACGGTTGCCTATGGGCAATTCCCGGATCACATAAAAATGGTCTAAAAAGGCGAATGATCAGAGATGAAAATGGTACTCA
TTTTGATCGCCCCTCCCCGCTTTATGACCAGAAAGAGTTTGTACCACTGGAAATGAAATCAGGTGACTTTGTTGTTATTCACGGCGATCTTGTACATCAG
AGCTTTGAGAACCTTTCTCCAGTGTCAAGACATGCACTGAGCTTACATGTAGTTGACATGGAAGGATGTAAATGGTCCAAGGACAACTGGATACAGAGGA
AAACTGCGCCTGAACCGCTCTATGTGTCTTAGTTCAGCCAGTTACTAATAAACCTGATATCTTCAGCAAGCAGTTTCAGTTGCTTATCATCGGTGCAAAT
TTGGGAACGCCGCGGAGCAATGCTGGTTTCTTTGTTGTCTTTCACATGTGTACACTGTAAATACTGAATACTAGCTGTTGTGTTGTCATGATATCAG
page-top