Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig142
Contig Information
Length 1166 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd10g01    rwhvd10g01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit UDP-D-glucose epimerase 1 [Hordeum vulgare]
Score 1437
Evalue 4.27993e-157
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig142
GCGACTTCCGCAAGGTGGACCTTCGTGACAAGGAGGCGCTGGACGAAATCTTCTCGACCCAAAGGTTCGAGGCTGTGATCCACTTTGCCGGGCTGAAAGC
CGTGGGGGAGAGCGTGCAGAAGCCCCTGCTTTACTACGACAACAACCTCATCGGCACCATCACCCTCCTCCAAGTCATGGCAGCACATGGATGCAACAAG
CTTGTGTTCTCATCATCAGCCACTGTGTACGGGTGGCCCAAGGAGGTGCCCTGCACCGAGGAGTTCCCGCTCTCCGCGACCAACCCTTACGGCCGAACTA
AGCTTGTCATTGAAGACATCTGCCGCGACCTCCAGCGCTCGGACCCCGACTGGAAGATCATCCTGCTGAGGTACTTCAACCCGGTCGGCGCGCACCCGAG
TGGCTACATCGGGGAAGACCCCCTCGGAGTCCCCAACAACCTGATGCCCTATGTCCAGCAAGTCGCTGTCGGGAGGCGGCCCGCGCTGACGGTTTATGGG
ACCGACTACAACACCAAGGATGGAACAGGGGTACGTGACTACATCCATGTTGTTGACCTGGCTGACGGCCACATCGCCGCCCTGAGGAAGCTCTACGAAG
ATTCTGACAGAATAGGGTGCGAGGTGTACAATCTGGGCACTGGAAAGGGGACGTCCGTGCTGGAAATGGTTGCTGCATTCGAGAAGGCTTGCGGAAAGAA
AATCCCTCTGGTTTATGCTGGAAGAAGAGCTGGAGATGCCGAGACTGTGTACGCTGCCACCGCCAAAGCTGAGAAGGAGCTCAAGTGGAAGGCCAAGTAT
GGGGTGGAGGAGATGTGCAGAGACCTGTGGAACTGGGCCAGCAAGAACCCCTACGGCTACGGATCCACCGACAACGGCCACTGATTAATAGACCCCAGAG
CCAGTAGCAGTAGCATATATACACCACCATCCATCTATATATTTATCCACCACAGAGAGCAGAGAGAAGAAGAGGAAGACTACTACTGATGTGTATAGGG
AGTGAGTGAGTGAGTCGGATCCATCAGTAGCTTATAATTAATTATATTGTTCGTGTTAGAAAGCTAATCATATCCATCTCCCTTATGGAGTAAGTAGAAG
AAATAAGGTTGGTTCCCTTGCCTTGTAGAAATATATATATAGATATCTTGTCGGTCCATGGAATAA
page-top