Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig121
Contig Information
Length 585 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd8g13    rwhvd8g13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein P1 [Triticum aestivum]
Score 309
Evalue 7.50542e-27
Total Hit Count 344
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig121
CTCCACTTCCATCGCCTCCCAAGAATCGCAGATCTGCTCCGGTGAGAATCCGTCGTCATGTCTTCCAGCGAGGTCGCCTGCACCCTTGCCGCCCTCATCC
TCCACGATGACGGGATCCCCATCACTTCTGAGAAGATCGCGACGGTGGTGAAGGCTGCCGGAATCAAGGTTGAGGCCTACTGGCCCGCGCTCTTCGCCAA
GCTCCTGGAGAAGAGGAGCGTCGATGACCTCATCCTTTCCGTCGGATCTGGTGGAGGTGGTGCTCCAGCTGCTGCTGCTGCTGCCCCGGCTGCTGGTGGT
GCTGCTGCCGCTGAAGAGAAGAAAGAAGAGAAAAAGGAGGAGGCTAAGGAAGAGAGCGATGATGACATGGGCTTCAGCTTGTTCGACTAAGCAGTTCAAT
TCCAGTTCTCCTGTGGAATCTTTTATGCTAAGGATTACTTATCTTATGTGCTTTTAGGTCGAATTTTGCGGATTTAATATGTTTGAGACCTAAGTATCTG
TGCAATGAGTACTGCAAACCACCTTGGGATGGTCTTTTTAGAATGAAAATGGTTTTGGTGCTTGGTTGAAAAGCCAAAAAAAAAA
page-top