Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig100
Contig Information
Length 823 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd13h12    rwhvd13h12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cp31BHv [Hordeum vulgare subsp. vulgare]
Score 871
Evalue 1.0489e-91
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig100
CGGGAACCTGCCGTATGATGTCGACAGCGAGCGGCTCGCTCAGCTCTTCGACCAGGCCGGCGTCGTCGAGGTCGCCGAGGTCATTTACAACAGAGAGTCA
GGCCAGAGCCGTGGATTTGGATTTGTTACCATGAGTACTATTGAGGAAGCTGACAAAGCCATCGAGACGTTCAATCGCTACGACATCAGTGGAAGGCTTC
TGAACGTAAACAGGGCAGCTCAAAGGGGCTCCCGTGTTGAGAGACCTCCTCGACAGTTTGCATCTTCTTTCAGGGCTTATGTTGGTAACCTGCCATGGCA
AGCGGAAGACTCTAGGTTGGTGCAATTGTTCAGCGAGCATGGGGAAGTAGTTAACGCTACAGTTGTGTACGACAGAGAAACTGGGCGTTCACGAGGATTT
GGTTTTGTAACTATGGCTTCAAAGGAGGATCTTGACAGTGCTATTTCAGCGCTTGATGGACAGGAGATGGATGGCCGCCCACTCCGAGTGAACGTTGCCG
CGGAGCGACCACAGCGAGGGTTCTGATGCAGAGGAGAGCGGGTGCTTCTTTTGGACACACGAGAGCAACACTGCTGAAATGTTACTGCAGAAGACTGAAG
CATGTCACCACTTAAAAATCCTGCACTAGCCTCCTGATGCTGGGCTATCTCCTCCCATCCCATGTTCTTTTTTCATGCTTCCGTTTGCTGCTGATGTCAT
CATGTTAATTTCTTGTCAACACCATGAGTTCAACTTTTCAAGTAGGCTACTGTAATGATGTCCTAGTGTTCTCATGATAATCGAAGAAGGTTTTGTTGGT
AATGCTAATATGATTATGTATGC
page-top