Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig99
Contig Information
Length 247 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd13h11    rwhvd13h11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC_Os03g57620 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 351
Evalue 2.10843e-34
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig99
CCGCAACTAAGTGCCAGATGCTCCACACGGACGTTGCTACTTGCCTGCACGTAGTAACTACTCGTATATGTGGTCAATAAGAAGGTAGGTGCATGTATGT
ATGTACGCGTACGTACAGATTGCACAGTTATGTTTACCCAATAATACCAGAACTCTGTTCTGATCGTGTATTCACCCTGTAAGACTTCTCTTTCTTGCAC
AATATATAATACATGCAACTGTCATGCATGTTATAATAAAAAAAAAA
page-top