Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig97
Contig Information
Length 1072 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd13h04    rwhvd13h04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1223
Evalue 2.47152e-132
Total Hit Count 407
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig97
TGGGCTCTCGACCCATCCCTGCTCGAACCCTAACCTCAGATGGCGCTTCCCGCGTGAGAGGACGCTGCCGCGGCAGCAGCGTTGAGGGGGGCTTCGTCGT
AGTCAGCGCGACAGATGTATAAGCAGGGGGCGGCCGGAGGTGCGGGGCCGGACCGGAAGCGCATCAGCGACGCGCTCGATAAGCACCTGGAGAAGGCGGC
CGCGTCGCCCTCCACGTCGAGAGGCTCGGCGGGTGCCCGAGGCAACCACAACCGCGTCGTAGTGCCGTCCTCCATCCCCAAGGGCCGCTGCTCCGAAGGG
GAGTCTGAATCTGACAGTGAAGCATCAGATGTTAGTGGCTCTGATGGAGAAGACACCTCATGGATTTCATGGTATTGCAACCTAAGAGGGAATGAGTTCT
TCTGTGAAGTCGATGATGATTACATTCAAGATGACTTCAATCTTTGTGGGCTTAGCAGTCAAGTTCCATATTATGATTATGCTCTTGATCTCATTTTAGA
TATCGAGTCTTCTCATGGTGATATTTTCACAGAAGAACAAAATGAGCTAGTGGAATCAGCTGCTGAGATGTTGTATGGGCTAATTCATGCGCGATACATT
CTGACCAGTAAAGGGTTGGCTGCTATGCTGGAGAAATACAAGAACTATGACTTTGGACGATGTCCACGGGTTTATTGCTGTGGCCAACCATGTCTACCAG
TTGGACAATCGGATATTCACCGATCTAGTACAGTGAAGATATACTGTCCTAAGTGCGAAGACATCTACTATCCACGGTCTAAATACCAAGATATTGATGG
AGCCTACTTTGGGACAACATTTCCTCACCTGTTTCTGATGACGTACGATCACCTCAAGCCCCAGAAGCCCTCGCAGCGCTATGTTCCTCGCGTATTTGGC
TTCAAGCTCCACAACCACAAGCCATGATGCGGAGGTGAAGGAAAAGATAAGAGGCCCCGGAAGACTACTGTAAGAGTGCAATCGCCAGATCATGCTGCCC
ACCCATATTGTGTGCCCTGTCTGGTCTATTTAACATTGAAATATTGGTATAAAAGAAGACATGAGACGATGT
page-top