Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig93
Contig Information
Length 838 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd13f21    rwhvd13f21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 838
Evalue 7.28513e-88
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig93
ACTCGGACAACCAGCCTGGGTGTGCTCATCCAGGTGTACGAGGGTGAGAGGACAAGGACCCGTGACAACAACCTCCTTGGCAAGTTCGAGCTGTCTGGCA
TCCCTCCCGCACCCAGGGGAGTTCCCCAGATCACGGTCTGCTTTGACATCGATGCCAATGGTATCCTGAACGTGTCTGCTGAGGACAAGACGACTGGGCA
GAAGAACAAGATCACCATCACCAATGACAAGGGCAGGCTGAGCAAGGAGGAGATCGAGAAGATGGTCCAGGAGGCTGAGAAGTACAAGTCGGAGGACGAG
GAGCACAAGAAGAAGGCGGAGTCCAAGAATGCCCTGGAGAACTACTCGTACAACATGCGCAATACCATCAAGGACGAGAAGATCGCCTCCAAGCTGCCGG
CCGACGACAAGAAGAAGATCGAGGATGCCATCGATGCTGCCATCCAATGGCTGGACACGAACCAGCTCGCTGAGGCGGATGAGTTCGAGGACAAGATGAA
GGAGCTGGAGGCCCTGTGCAACCCCATCATCGCCAAGATGTACCAGGGTGCTGGTGCCGACATGGAGGGCGGCATGGACGACGACACCCCAGCTGCATCC
GGCGGCCCTGGCCCCAAGATCGAGGAGGTCGACTAAACAGTCAGTTGTTCTGTTGCAGAGGCGGCGAAGCCTGCTGCTTATTATACCGTGTCTGTGTTAT
CTGAGACTTGAGGTTGTGGTGGTTATTGTTTTGCTTCCGAGTGGTCGGAGTTATTCCGTGCGAGTTGCAACATTCGTGGTAGTGGATCAAGGGTTATGAT
GTCTCACGTCTAAGTATATTATTAGTTTGTTGGTATTT
page-top