Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig91
Contig Information
Length 821 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd8j07    rwhvd8j07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_26084 [Oryza sativa Indica Group]
Score 1092
Evalue 2.46167e-117
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig91
AGCCAATTCTGGATAGTCGATGCTCACGGTTTAATAACAGAGGAACGTGTAGACATAGACCCAGATGCACGTCCTTTTGCTAGGAGAAAGAGTGAGCTAA
CTCATCAAGGCCTAAATGAGGGTGCAAGCTTGATTGAAGTGGTTAAAAAGGTGAAGCCTGATGTCATACTTGGACTATCTGCTGTTGGTGGTTTGTTCTC
AAAGGAGGTTTTAGAAGCACTAAAAGATTCGTCCTCTTCCAGACCAGCAATTTTTGCGATGTCAAATCCAACTAAGAATGCTGAATGTACACCTGAAGAA
GCCTTCTCAATTATTGGTGAAAAGGTCGTATTTTCCAGTGGAAGCCCATTTGATGATGTGGATCTTGGTGACGGAAAGATCGGCCACTCTAATCAAGGGA
ATAACATGTATCTCTTTCCTGGAATAGGACTTGGAACCCTGTTGTCTGGTGCACGGATTGTCTCTGATGGAATGCTTCAGGCGGCGGCAGAGCGCTTGGC
TTCATACATGAAAGAGGAGGAGGTTCTCCAAGGGATAATTTACCCTCCAACCTCCAGAATACGTGACATCACTAAGGAGGTGGCGGCAGCAGTTGTGAGG
GAAGCTGTTGCAGAGGACCTAGCTGAGGGATACCGTGACATGGATGCACGCGAGCTTGCAAGACTGAGCGAGGAAGAAACAGTTGATTATGTCAAGAACA
ACATGTGGAATCCAGTTTATCCAACAGTAGTGTACAAGAAAGACTAGAATTCTACTCATGCTGTAAAATACATGCTCATTCATCATGTGCAATTTACCTT
AGGCTATTCTTTCGATCTTTG
page-top