Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig90
Contig Information
Length 688 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd8j11    rwhvd8j11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0526300 [Oryza sativa (japonica cultivar-group)] >gi|38344441|emb|CAE05647.2| OSJNBa0038O10.13 [Oryza sativa (japonica cultivar-group)] >gi|113564933|dbj|BAF15276.1| Os04g0526300 [Oryza sativa (japonica cultivar-group)] >gi|116310962|emb|CAH67898.1| OSIGBa0115K01-H0319F09.4 [Oryza sativa (indica cultivar-group)] >gi|125549090|gb|EAY94912.1| hypothetical protein OsI_16714 [Oryza sativa Indica Group]
Score 704
Evalue 1.71247e-72
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig90
CGCGCAACAGGGTCCCGGACCTCGACGGGCTCCCAGACCCGAGGCTCCTCGCCACGCACGTCCCGCTCGCGTCGCTGCCGAGGTCCGTCGCCGCGTCGGC
GTGCAGGATCGTGTACGTGTGCCGCGACCCCAAGGACACCCTGGTCTCGACGTGGACCTTCGTGAACAAGTTCAGGGCCGAGGACGGGCTGGAGCCGATC
TCGGTCGAGACCGCCGCCGACTACTTCTGCGACGGCGTGTCGGCGTCCGGGCCGTACTGGGACCACGCCCTCGGGTACTGGCGCGCGCACCTGGCGAACC
CCGAGCGGGTGCTCTTCTTCAGGTACGAGGAGATGAGTCGGGACCCTGCAGCCCACGTCCGGAGGCTGGCGGAGTTTGTCGGACGCCCGTTCAGCGCGGA
GGAGGAGGAAGATGGCGCGGTGGACGCCGTCGTCAAGCTGTGCTCGTTCGAGCACATGACCGGGCTCGAAGTGACCAAGAGCGGCAAGACGGAGCTTGTG
TTGGGCGCTGTGGAGAACAGCTCGTTCTTCCGGCGCGGCCTGGTCGGGGACTGGGAGAACTATCTGTCGCCGGAGACAGCACGAAAGATCGACGCCATTA
CCGAGGCTAAGTTCAGGGGTTTCGGTCTCTCTGTCTAGCTAGCATTCGGTATCCGCGTGTCATTCAATATTCGCATACGTGTGCCGCT
page-top