Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig89
Contig Information
Length 409 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd11h02    rwhvd11h02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative NADH dehydrogenase (ubiquinone oxidoreductase) [Arabidopsis thaliana]
Score 282
Evalue 5.96067e-24
Total Hit Count 344
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig89
CAAAGCTCTGGTGGACCTGAGGCAAAGCAAGGACTCGAAGGGCATATCCATTGCAGGATTTGCAAGCTGGTTCATCTGGCGCTCAGCGTACCTGACTCGT
GTTGTCAGCTGGAGAAATAGGCTCTATGTGGCTATCAATTGGCTGACCACGATGATATTCGGCCGTGACATAAGCCGTATCTAGGGTATCTATCTGAGTA
TCTGTAGATCTCTGGGATCTGAACTGTATGAGTTCGATACAATATATAGGCCACGAACACTACAAGAAATATGGGTCTAGATCATCTTTTTTCCCCTCCT
GCTCCTCTGTATCCCCTTCAGACACGTGAGTTCCAAATGCACAATTTTTGTTTTTGTAAATTATGAATAAATGAGATGCAATTTGATGATCTTCAAGTTA
AAAAAAAAA
page-top