Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig88
Contig Information
Length 297 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd8o11    rwhvd8o11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 131
Evalue 1.93772e-06
Total Hit Count 265
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig88
GCTGCCCGGTCGATTACGAGATGCACTTCTATACCATTCCAACTTGAAGGTGTGAAATTTGAGCTTCAGAGGCAAGGGCGCTGCCTTATTACATATGAGA
TGGGGCTTGGCAAGACTCTCCAAGTGAGCATATTGTATTTTGTGTATAACTATCGTGCGGATAGTTTATATGCAGAAAATTGTTTGTTCCACGGTGTTAC
AACTTGTAAAATACAGTAAATTGGCTTATGGATATTGAGCGCACTGATATTGAGCTTGCATCAATACATTTTGGGCAGTAACAGATTAAAAAAAAAA
page-top