Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig85
Contig Information
Length 1161 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd13e17    rwhvd13e17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Alpha-2-macroglobulin, N-terminal [Ralstonia eutropha JMP134] >gi|72120480|gb|AAZ62743.1| Alpha-2-macroglobulin, N-terminal [Ralstonia eutropha JMP134]
Score 85
Evalue 2.51954
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig85
CCCCAGCCGAACACAGTCCCAATCTCGACACCCAAAGGAGCACACCAACGCGAGAGGCCGGATTGAGCCCATCCCCTCCGCCATGGTCAACGGCCCGCCG
CCCATGATGGCACTGACGCCCCCCAATTTCCCATGCTAACGCGTGCGAGGCGGCGCCATTGGATCGATGGCGCGCGTGCGCCCTAATGGTAGGGCGGCGT
GCAGGAGGTCCCCCTTCTCCTCTCTCCCCCTGCGCGCGCTGGAGCTTGAGCTGGGCGGGACGCTGAGCGGGAGTTCTTGCTGGCAGAGGAAGAAGACGTT
CAGGTAGAAGGCGTGGACGTTGGGGAGTAGCTGTGTGGGAGGAGGGCGTCAACGGTGGGATGGGTGCTGGCTGGCTGGTACTCGTGAACCATGGTGAAAA
AGGGATCGGTGCTGCAGCGGTAGGCGTCTGGTGGCTATGCAGTGGCAGCCGCTACTTAGATACGTAGCCGGCAATGGTGAGAAGACTTTGATCTTGATAT
ATTAGATGTAAGCCCCATACACCATAGGAGGACCGCCTTTTGGTGATATCAGCCGGATGATAAAAAAGAAGAAGAAGATGATTCAGTTATCAAGAGGATG
TCTGAACTCTGAACCTGAAGGACAGGAAATAAAACATGAGGAGGATAATGGAAGAGAAGAAGAAGCAGACATTAAGATAATGAAAGAGAATGAGTAGATA
ATGAGGATGGTACTGAAAGAGAAGACGAGATGCACCTTGGCTAAGTAAAGAGTTAGACCTGAAATTGCCAATAAAGGGAATGAGGTCCCTTTCTCTATAG
AATATAGAAGGCAGCTTCGCAGAGGGGTCACTGACGAGCAAGAGAAATAAGCCCTGGAGCATGTTTCAATGAAGACTACTGATCTAGAATTGCCGTATGT
TCATGAACAATTTTTTGTTGCTGAAATAAGTCCTAGAGCAGGCTTCGGTGAGGACTACTGATCTAGAAGCCATATGTTCATGAACAATTTTTTGTTGCTC
TGACTGAACGGACTGTCTCTGTAATTCTTGTCTGTTTGGGTGGTCCCCAGCTGCGACAAGATGTCTTCTTGCTGAACAACGCCACAATTGGATAGTTGTA
TGTTATTTAGGATTGCCTCTGTTGCATACCACCTGGAGTTACAAGAGGTCCTGTACTAATT
page-top