Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig84
Contig Information
Length 642 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9p09    rwhvd9p09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit peroxisomal 2,4-dienoyl-CoA reductase [Zea mays]
Score 655
Evalue 7.08881e-67
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig84
CCTCGTGCCGCTCCACTGGTGGCCTCATCATTAACATAAGCGCGACACTGCATTACACTGCTTCTTGGTACCAAATTCATGTCTCCGCCGCTAAGGCAGG
TGTTGATAGTATCACAAGAACGCTGGCTCTGGAATGGGGAACAGATTATGAAATTAGGGTCAATGGAATTGCACCAGGACCAATCGGCGGCACTCCAGGA
CTAAGGAAGCTTGCACCTGATGAAATGGGCAAGGGGAAAAGGGAAATGATGCCTTTATTTAAGTTGGGGGAGACACGGGATATAGCAATGGCCGCGCTCT
ATCTTGCTTCCGATGCAGGCAAATATGTAAATGGGACTACAATGGTGGTTGATGGAGGGCTTTGGTTGAGTCACCCTCGCCACATCCCCAAGGAGGAAGT
GAAGGAGCTCTCAAAGGTGATCGAGAAGAAGGTTAGGGCCTCTGGTGTAGGTGTACCGTCCAGCAAGTTGTGATGACATCCTTGGTTTATGTCACTGTCT
CATGTATATCATATACCACACTTCAGTATTGTAGTCAGCCAGCAGCTCAGCACCAACTTTATTGTGTACCGTGAATCTTGTAACCCTGCTGAGCAGAATT
GGTTTCAAATGAACAACTTCAATATTTACCTCAAAAAAAAAA
page-top