Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig83
Contig Information
Length 811 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd11h21    rwhvd11h21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_004536 [Oryza sativa (japonica cultivar-group)]
Score 833
Evalue 2.5977e-87
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig83
CGACATCATGATGGGAACATTTACAAAATCGTTTGGATCGTGCGGAGGTTATATTGCAGCATCAAAAGAGATCATTCAACATCTCAAGCACGCATGCCCA
GCCCATATTTATGCAACATCCATGTCGCCTCCAGCAGTCCAGCAGGTCATCTCTGCGATAAAGGTCGTCCTTGGGGAAGATGGATCTAACAGAGGGGCCA
AGAAACTTGCTCAGATTCGGGAGAACAGCAATTTTTTCCGTTCAGAGCTTCAGAAAATGGGTTTTGAGGTGCTGGGAGATAATGACTCACCTGTCATGCC
TATCATGCTTTACAATCCTGCTAAAATTCCTGCATTCTCAAGGGAGTGCTTGAGACAAAATGTTGCTGTTGTGACTGTTGCATTTCCTGCAACGCCACTA
CTACTTGCCAGAGCTAGGATATGTATCTCAGCTTCTCAATCAAGGGAGGATCTAATTAAAGGGTTGGAGGTTATCAGCAAAGTTGGTGATCTCATCGGAA
TCAAGTACTTCCCCGTTGAGCAAGAGAAGGTTGCATCTGTTGACAAACTTAAGAAGCTTGAGTGAATAGTGACAATGGACAATTGGAAGAATTCTGCTGC
TGTTATGCTAGATCTACTGGGTCATCTTGGTAGTGCACCATGCCTCGGTTTTGCTCTTTTGTGCACCTCAGGACCCTTCATTTTCCTTTGTCTGAAGTGG
TTTTGATTTTGTACAGACTGTATTATCATCCATCATAGTTTGAAACTTAAACACGGCTCTATACACTGTTTTGTCGAATTCAAGAAAAAAGAAATCCCTG
TAAAAAAAAAA
page-top