Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig82
Contig Information
Length 1075 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd13e11    rwhvd13e11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0681800 [Oryza sativa (japonica cultivar-group)] >gi|31712071|gb|AAP68376.1| putative protein phosphatase 2A regulatory subunit B' [Oryza sativa (japonica cultivar-group)] >gi|108710424|gb|ABF98219.1| transposon protein, putative, unclassified, expressed [Oryza sativa (japonica cultivar-group)] >gi|108710425|gb|ABF98220.1| transposon protein, putative, unclassified, expressed [Oryza sativa (japonica cultivar-group)] >gi|108710426|gb|ABF98221.1| transposon protein, putative, unclassified, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549379|dbj|BAF12822.1| Os03g0681800 [Oryza sativa (japonica cultivar-group)]
Score 1151
Evalue 5.54372e-124
Total Hit Count 452
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig82
ACATTTCGACTCCGAGGACCCCCGCGAGCGCGAGTACCTCAAGACCGTGCTCCACCGCATCTATGGCAAGTTCATGGTTCACCGCCCGTTCATCCGCAAG
GCCATCAATAATGTGTTCTACCGCTTCATCTTTGAGACCGAGCGCCACAACGGCATTGGCGAGCTCCTTGAGATTCTCGGCAGCATAATTAATGGCTTTG
CCCTGCCTATGAAGGAGGAGCACAAGCTGTTCCTCAGCCGCGCGCTCATCCCGCTGCACAAGCCCAAGTCCGTCGGAATCTACCACCAGCAGCTGTCCTA
TTGCATTGTCCAGTTTGTCGAGAAGGACTACAAACTTGCCGATGCGGTCATCAGGGGTCTCCTCAAGTACTGGCCACTCATAAATTGCCAGAAGGAGGTG
CTGTTTTTGGGGGAGCTCGAGGAAGTGCTCGAGGCCACACAGCCTGCTGAGTTCCAGCGGTGCATGGTGCCGCTGTTTAAACAGATAGGGCGCTGCCTTA
ACAGTGCCCATTTCCAGGTTGCTGAGCGGGCTTTGTTCTTATGGAACAATGATCACATCGTAAGCTTGATTGCCCAAAATCGTGGTGTTATATTTCCAAT
AATATTTGAAGCACTTGAGAGGAACATACAGAGCCACTGGAATCAAGCTGTTCATGGCCTGACCGCAAATGTGCGCAAGATGTTTTTGGACATGGATAGT
GATCTATTTGATGAGTGCCACCAGCAGTACGTTGAGAAAGAAGAAAAAGCCAAAGAATTGGAGGAGCAACGGGAATCGGCATGGAGACAATTGGAAGCTG
TTGCTGCCAAGGCTGCTGGGGATGACATGGTTTTGGTCAAATAGGTAATATATTCATCCCGCTTTCATTTCTTCGTTAGTGGTTGCGTCACTAAGCTAAA
GCTATTGTTTTAGTCTTGTAAGTTAAACCTGTATCACTGCTGGTTATGTATGTTCTCCGTTATGATTTTCCCTTTTGTTTTTAAGCATTTCTATGAGATG
CATTACCACCTTCTGTACTGCTGAGTCTTTGTTTTTAATTTGGTCATGGCAGTCCACAAAAAGATGGAATATGTT
page-top