Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig81
Contig Information
Length 753 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd8k09    rwhvd8k09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194703792|gb|ACF85980.1| unknown [Zea mays] >gi|195615288|gb|ACG29474.1| 60S ribosomal protein L18a [Zea mays] >gi|195627346|gb|ACG35503.1| 60S ribosomal protein L18a [Zea mays] >gi|195627434|gb|ACG35547.1| 60S ribosomal protein L18a [Zea mays]
Score 914
Evalue 9.18288e-97
Total Hit Count 306
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig81
TTAGGTTAGGCTAGGGGCTTCACAGAGCTCGCGGAAATGGTGGCCTTCAGGTTCCATCAGTACCAGGTGGTGGGTCGTGCGCTGCCGACGCCCGGCGATG
AGCAGCCGAAGATCTACCGCATGAAGCTCTGGGCCACCAATGAGGTCCGCGCCAAGAGCAAGTTCTGGTATTTCCTGAGGAAGCTGAAGAAGGTGAAGAA
GAGCAACGGCCAGATGCTCGCCATCAACGAGATCTTTGAGAAGAACCCAACCACGATCAAGAACTATGGCATTTGGCTGCGTTACCAGAGCAGGACTGGC
TACCACAACATGTACAAGGAGTACCGTGACACCACACTAAATGGTGCCGTGGAGCAGATGTACACTGAGATGGCCTCTCGCCACCGTGTGAGATCCCCCT
GCATTCAGATCATCAAGACCGCGACTGTCAACTTCAAGCTATGCAAGAGAGACAACACCAAGCAGTTCCACAACTCCAAGATCAAGTTCCCCCTTGTGTA
CCAAAAGGTCAGGCCACCAACCAGGAAGCTGAAGACCACCTACAAGGCAACGAGGCCGAACTTGTTCATGTGATTGGGCTGTGGTGGATGCTGTTAAGAG
TTGAAATGTTTTCTTCGTATGTTGGATCTTCTGATGCATGAAGACAAGCGTTTTGTTGCTTATTTATCGGTTAAAGACATGGTTGGTGGACCTTCTGATT
GTGTTCTTATCAGTAATCTGCATACAATCTATTGGTACCTGATAAAAAAAAAA
page-top