Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig80
Contig Information
Length 578 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd13e05    rwhvd13e05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutamate carboxypeptidase 2 [Zea mays]
Score 222
Evalue 8.9628e-17
Total Hit Count 95
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig80
ATCATTCCCTTCAATTATGTCCTCTACGTGTCTGAACTGGAGGTATTTTCTCTTCTGGCAACTGAGATAGACACACAGGGTAATCCCCTAATTCAGTTTC
ATCAAGGAAACTGAAACAGAATCATGAATTCATGATAGACTCGCTTCTTATTGATCGATGTTGCAAGCACAAAAGAAGGGCCATAACACGAGGGTAAGCA
TGTCTGAAAGTCAAAGAGATCAATGACCGATGGACGATGGCGGAGCGAGCCTTCACCAACCAAGAGTGGCTCGGAGGGAGACCGTGGTCCAAACATATGA
TGAGCATCAAAGCTGCAGATTTATGCCTCGTCGGACCAGGACGACTGGTGGGTACCAAAGCCTTCCCCGGCATCGTCTCGGCCATCGTGAACGCGCAGGA
GCTCAACACGTCGGAATCTTGGCGGCTGTTGCGGCATGAGATTTATCATGGGTGCAAGGACCTTATCTGTTATGAAATGGCATATTGTTATTCGTATGTG
TATTATTGACTTGCCAAATTCTTGACCGCCTATGGTATGATCAGATCAATATAAAGAGTGTGGCTTCTAAAAAAAAAA
page-top