Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig79
Contig Information
Length 305 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd13d24    rwhvd13d24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit catalase [Euphorbia characias]
Score 80
Evalue 1.57733
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig79
CAATTCTACAAGCCACCTGACCAGGGAAACCTACTCTCCGGTCTCGTGGCTGCGAATAATTTTGAGCTCGGAACACTCTGTTTGTGGCTTGCCGCCTTTC
TTTTTTCGGCTGTGTGGACCTTTTACAGCTTCTGATTTTTCTCGCATCTCCAGGGAGCCGGAACAAACACCTGTTTGTACCGATCCCCTTTTCATCTTTT
CCTGATGAACTGCTTGTATTCGGAATAAATCCATCTGCGTGTGATGATGGAAGGAACCTGTTCTCCAGAAATAATAATTCAGAGTGTTTGGGACGAAAAA
AAAAA
page-top