Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig78
Contig Information
Length 1218 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd13d23    rwhvd13d23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_37135 [Oryza sativa Indica Group]
Score 914
Evalue 2.02689e-96
Total Hit Count 122
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig78
TGGACCTGAGTCTCAAGGGATTGGGCTGACTCAAGTTACAGAGGAAAGACTGGCACTGACTATATTGTTGACGAGCTGAGCAAGAAACGGCGATCTGTCA
TCTTCCTTGATAATGTCGATAAAGCTGACTGCCTTCTCCAGGACACTCTGACTCATGCCAGTAAGACTGGTAGATTCCGAGACTTGCGTGGCAAGGAAGT
TGACATTAATGACTCCATTGTTGTGCTGTCAACAAGAACAACCAGAGGCTCCAAAAGCGTGTCTGTTGGAATGGAAGAGGGTCTTACTTTCACTGAAGAT
AAGATCCTGGCAGCTAGTGGACATCAACTGAAGATCCTGGTAGAATCATGTACGGCGATCACCGGTGAAGGCCACGGTGATAAGGTGATAGTTTCCCCCG
GGCACCCTCTAGCCAAAATTCATGCATCTTTGTACTGTGGGGGTTCAGTCAGCAAGCGAAAGTTCAACATTTCTGATGACCAAGAAAAGCTGCAGCAAGA
ATCACCGAGCATTTCCAAGCGACTGCACAGAACATCAAGTGTTCCGTTCGACCTGAACCTCCCCATCGACGAGGATGGTTCGAGCGATGCTGATGACCAC
AGCGGCAGCAATGACAACTCATATGGCACTCCGGAGAGATCCATGGACAGCCTCTTGTGTTTGGTTGACGAGTCCATCGATTTCAAGCCATTCGACTTTG
ACAAAGTCGCCGACTACGTACTGCAGGGAGTTGAGCAATACACTCCGCAAAAGTTCTGGGCTCCGGCTGCACATTGGAAAATTGATGTCGGTGCAATGGA
GCAAATAATTGCAGCGGCATGGGCATCAGAGGGCAAGAGGCCTCTCCAGGCCTGGCTGGATCAGGTGTTCGCTGGAAGCCTTGGGGAACTGAAGGTCAAG
TGTGGTAAGCATGCCAGCAGTTCCACTCTTATACTAGTGGCCTGTGAGGACATGGCAGCAGTCAGGGAAGACAATGGTTTTGGAGGTTTGCTCTCCTCCA
GAATAATTCTAGAATGGTGAAATGATGGTATCTGTATAGGGATAATTGTAATTATTTCTAGCTATTAGTCCACAATAGTATAGCATTATTTTGCCGGGAA
ATAATTTGTAGCATAGTTGATGATGCATTGCCTTCATATATATCGGCAAGTATATATTGATTGTAACACTTGTGGATTTGCCAATATATCACTGTTATAT
ATGGTGATGCAGAGGTAG
page-top