Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig75
Contig Information
Length 1069 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd8k24    rwhvd8k24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_20657 [Oryza sativa Indica Group]
Score 586
Evalue 6.06374e-101
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig75
TTTGAAAAGATGAAGCGCAACAGCAAAATCGGAAAAGAAATCGTTGCTGCCATCAAGAAGGGTGGTCCAAGTCCTTCGTCCAACACAGCTTTAGCAGCGA
TACTAGAGAAAGTAAGAGAGCTTGATGTCCCCAAGGAAGTTGTTGAGCGTAACATCAAAAGAGCTTCAGAAAAGGGTCAAGATACTTACACAGAAAAGAT
TTATGAGGTCTATGGTTTTGGTGGAGTAGGTATGGTCGTTGAGGTCCTTACAGACAAAATTACAAGATCTATTGCGGATATTANAAATGTTGTAAAAGAC
TGTGGAGCAAAATTGGCTGATCCTGGATCTGTTACATTCAGATTCAGACAAGCTCGAGTGGTTAACATAAAAGGTTACAGATGCCGATAAGGACCAACTA
CTCTCTGTTGCTTTGGATGCTGGCGCCGATGATGTTATTGAACCAAATTTTGATGATGAAGATGACTCTGAAGAGGTTCTAGAGAGGTTTTACAAGATAG
TTACTACATCTGAAAACTATCCTGTTGTGCTATCAAAGCTACAAGAGGAAGGGCTGAAATTTGAAACGGATAACGGTTATGAACTGCTGCCTCTCAATCC
GATTGAGGTGGATGACGAGGCCATGGAACTTAACAAGGACCTTGTATTGAAGTTGCTTGAATTGGATGATGTTGATGCTGTCTACACAGACCAGAAAGTG
AGCCAATTTGGAACCCACAGGCTCTCTCAGCTCTCAAGACGCTGCTCGATGACTCCATTTGGGTAGGGCTTGTTTTCAACTTCGTGTCCATTAAGGATTT
CTTATCAGCACTGTTTGCGCCGATTACGAAGCCTGCACTCGTAACATCAGCTTCAAGTGTCCAAAATGAAAATTGGTGAACGCAGCAGTTTCCTTTTGGG
GGTACTTTTCCCCACATTCTGCCGTCTCATAGTTTTTTACCTTACGTTTGTTGTCCCTGATCTCTTCACCTTGTCCGTGTCTCAGTGAGCTGCTAGATCG
CTGCTCATATAACGAATGTTGTAGCTGCATCTTTTNCATGTGATTGTAAGCAATACAAGTAAAACTGAC
page-top