Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig73
Contig Information
Length 630 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd13d07    rwhvd13d07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0314800 [Oryza sativa (japonica cultivar-group)] >gi|113532404|dbj|BAF04787.1| Os01g0314800 [Oryza sativa (japonica cultivar-group)] >gi|125525617|gb|EAY73731.1| hypothetical protein OsI_01606 [Oryza sativa Indica Group] >gi|125570119|gb|EAZ11634.1| hypothetical protein OsJ_001459 [Oryza sativa (japonica cultivar-group)]
Score 244
Evalue 3.07297e-19
Total Hit Count 62
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig73
CGAGAGAAAATAGAAGAGAAGAGAAGAGGAAGATAATCCTGACCCCATGGAGAGAGTCGCGTCGCGCTGTGTCAGCCTCCTCGCACAAAGGAGGGGCTAC
TGTGCGGCCGCGGCCATGGTGAAGGGAGCAGGGAGGAGCGCCGCTGCTGAGGAGAAGACCGCCGTCGCGGCGAAGAGCGCAATGGCTGCGAGGAAAGACG
TGGGCGCTGGCGTGGAGAAGGCGGCGTGGGTGCCGGACCCGGTGACCGGGTACTACCGGCCGTCGGGCGCCGCCAAGGAGGTGGACGCGGCTGACTTGCG
CGCCAAGCTGTGCTGCTAAGCAAAGCAAGGGAACTAATTGACGGCCGCCCGTCAAGAACATATTTTCCCTTAAGCGTAAGCGTAAAACTGAACACTGTGA
GGCGTTTCCACAGCTCTGATCGAGCATGGCTTTGCCTTAGGATACGTGCTCTCATCTCATTGATCGCTATAGTCCACTTTCTCCTAGCGCGGCGTGTCCA
GGAGAATTCGCCTTCCCGTTTCTCTTCTCGATGTTCGCATGATACAAGAATATATAATTTTGTACTGATTGATTAAATAATGANTAAAGTGTTCCCGCAA
AAAAAAANANTAAAGTGATTAAAAAAAAAA
page-top