Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig72
Contig Information
Length 994 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd8l18    rwhvd8l18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit oxidase [Triticum aestivum]
Score 1127
Evalue 2.98363e-121
Total Hit Count 267
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig72
ACGCGGCAGGAGAAGGACCAGCAGGAGGCCGAGGTGGCCGCCGCCGAGGACTCCTTCGCCGTCAGGGAGGCGGCCGCCACCCCTCCGGAGGAGGAAGGGG
GATTCGACGAGGAGCTCACCCTCGCCGGCGAGGACGGCGACTGGGTCGTCAGATTCGAGCAGTCCTTCAACGTATTCCTCACGGATACTGTCATCTTTAT
ACTCGATATTCTGTATCGTGACCGCGACTACGCAAGGTTCTTCGTGCTCGAGACCATCGCCAGGGTGCCCTATTTCGCGTTTATATCGGTGCTTCACTTG
TACGAGACCTTTGGATGGTCGAGAAGAGCTGATAACATCAAAGTGCACTTTGCTGAAAGCATGAATGAGTTCCATCACCTCTTAATCATGGAGGCATTGG
GTGGCAACTCTGTATGGCTTGATCGCTTTCTTGCGCGGTTTAGCGCCTTTTTTTACTACTTCGTCACTGTTGGCATGTACATGCTGAGCCCAAGAATGGC
ATATCACTTTTCTGAATGTGTTGAGAGGCATGCATACTCAACTTATGACAAGTTCCTTAAGCTCAATGGAGAGGAGTTGAAAAAATTACCAGCTCCAGAG
GTGGCTGTAAACTATTACATGAATGAGGATCTCTACATGTTTGATGAGTTTCAAACATCAAGAGCTCCAAATTCTAGGAGGCCTAAAGTTGATAACTTGT
ATGATGTATTCGTGAATGTACGGGACGATGAGGCGGAGCATTGCAAGACAATGAAGGCCTGTCAAACGCATGAAACCCTCCGTTCTCCTCACGCCGTGCA
GAGCTCAGTAGAAGCTGATGCAGAATGATTCTGTCAAGAAGTCCCTTGGAAATGAAGACTGACCGGTTGTACGTACCTCCGTGCTAGAGCATCGTAGAGT
ATCATACTAAATTTTGGTGATATATTGTATTCCATCCTTTTTCTCCCTTCTCTTCGTATGTAGACATTAGCCAGACTTCCGTACTTGTGAATCT
page-top