Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig68
Contig Information
Length 598 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd8m05    rwhvd8m05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0377400 [Oryza sativa (japonica cultivar-group)] >gi|108708439|gb|ABF96234.1| retrotransposon protein, putative, unclassified, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548697|dbj|BAF12140.1| Os03g0377400 [Oryza sativa (japonica cultivar-group)]
Score 430
Evalue 7.4098e-41
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig68
TAATCGCCCCTGCCCCAAGCTCGCCTACAAGTTCTTCGGACCGTTCACTGTCCTGCAACGCATTGGCGCCATGGCATACAAGCTCCAACTGCCGGACAAC
AGCCGGATACACCCAGTTTTCCACGTGTCACAGCTGAAGCCTTTCACACCGGACTACTCGCCGGTCTTCTCCGAGCTGCCTCGCGCGCCAGACCTCACCG
CGGCTCCCCTCCAACCCGTGGCCATCCTGGATCGACGGATGGTCAAGAAAGGCAACAACTCGGTGGTTCAGGTGCGCGTTCAGTGGTCATCTCTTTCTCC
AGCGTCAGCAACCTGGGAGGACTACAACGTGCTGCGCCTTCGCTATCCTACGGCACCTTGCTGGAAGAACGACGCTGCCGCTCAAGGCGGGGCAACTGTC
ACACCTGATACATCTGATACAAGTGTAGCGGTGGACATGTAATAGGTGAGGAGAGAAATTAGGCCAGAAGCAAGTGGGCTGGAGCCGTGGATGTAATGGG
CCGCGTATGGCCCTGGAGTGGGGTACTTAACCCATCGTGTATCAGTGGACTGGTTATGCAATGAGAAAACACTAACGACTCTGTTCCCAAAAAAAAAA
page-top