Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig66
Contig Information
Length 554 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd8m24    rwhvd8m24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LACBIDRAFT_293419 [Laccaria bicolor S238N-H82] >gi|164647038|gb|EDR11283.1| hypothetical protein LACBIDRAFT_293419 [Laccaria bicolor S238N-H82]
Score 101
Evalue 0.00843639
Total Hit Count 14
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig66
GCACACAGCTCAAATTAAGCCTCGAGATGGCTAAGTAGTCACAACTGACCACAAGATGGCGTCGCTGGCCAGGGCTGCCCGTCTCCTGGTGGTCGCGTTG
CTGGTCGTCTTCTCCGCTGCTATCACGGGCTGCCACGGAGTTCACAGGGAGATCAGCGGTCGACCCGGGTCAATCCCAAGCACACCGCGTGGTATCATTC
CCCGTCCCCACATTCCGATTCCATGTGGCCGCGGACTATTTCGATGCCCACCGCCGCCACGCGGTGTCGGTGCACCTCCCCCTCACCCGGACAATGGAGG
GCAGCCTTGATGCATGCAAGCTAGCTAATTCTTCCACGTACGGCCAAAGTCAACTATATATATTCGCAATAATATGCGCTCGATCGGGTACTTGATAATA
AAACTTGAGTATGGCCCTGCTCTCATGTGGGTGTGCACTTAAATTTTTGTTTGGAACTTTGGGTGTGAACTTAATTAGTTACAACGTGTAATCAATAAAA
CTGCTTCCGTTCAGAATCATAATAAAAAATACTCTTTTTATANTAAAAAAAAAA
page-top