Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig60
Contig Information
Length 1081 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd8o10    rwhvd8o10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09747 [Oryza sativa Indica Group]
Score 522
Evalue 5.78108e-128
Total Hit Count 417
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig60
ACCCAATCAAGGAGTGGATCCTCACCGAGGGGAAGGCCACCCAGATCACAGGGACCAGCTCCATTGGGGGCGGCTGCATCAACGCCGCCCANCGCTACGA
CACCGATGCTGGCTCCTTTTTTGTGAAGACCAACAGGCGCATCGGTCCAGCTATGTTTGAAGGAGAGGCTCTGGGCTTGAAGGCAATGTATGACACCAAG
TCAATCCGTGTTCCTTTGCCGTACAAGGTTGGCTCGTTACCAACTGGTGGTTCTTTTATCATCATGGAATATATTCAATTTGGTCGTTCTAGGGGTGACC
AGGTAACCTTGTCCCGAAACCCCTTTCGTTCAAAGAAAAAGTCAGCTCTAGGAAAGAAAGCTGGTCGAAATGCATAAAGCTGCAAAATCTGACAAGGGAT
ATGGTTTCTACGTCGAAAATACTATTGGAAGCACTCCGCAAATTAACACTTGGACTGCTGACTGGATTGAGTTTTACTCGAAGCATAGACTGGGATACCA
GTTGAAGTTGATATCGCAACGGTTCGGAGATTCAGCCATATATGAAAAAGGTCAACAATTGATTGAGAAAAATGCATCCACTGTTTGACGGTGCTGTTAT
TGAGCCATGCCTGCTTCATGGAGATTTATGGAGTGGAAATATAAGCGCTGATACCAATGGAGATCCTGTAATATTGGATCCAGCATGCTACTATGGACAC
AATGAAGCAGAGTTTGGGATGTCCTGGTGTGCTGGATTCGGAGGGGAATTCTACCGCTCCTATTTCGAGGTGATGCCGAAGCAGCCAGGCTTTGAGAAGA
GGAGGGACCTGTATCTCCTGTACCACTACCTGAATCACTATAACCTTTTCGGCTCTGGGTACCGCTCCTCGGCTATGTCCATAATCGAAGACTACCTGCG
GATGCTGAAGGCATAGCCGCGTCTTCTCTTTGAGAATTGAGAACAGGGAATTTCCCACCTCTGCTTCTCCCCAGAATGGCATGCACGTATAAATGACATG
GTCTATATGTACCCCTTGATATGTTGTGGATTAGTAGTGACATCCTTACATTCTGTTGTAAATTCACTATCAACTGAATTT
page-top