Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig59
Contig Information
Length 770 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9n21    rwhvd9n21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|219884535|gb|ACL52642.1| unknown [Zea mays]
Score 208
Evalue 8.5297e-16
Total Hit Count 31
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig59
TGAACTTTGCCAATGTTGACTTCTAAAAGTAGTTTACATGTGAGAAAAATCTCAAAATCTTTTCATCTTGTAGGCTCAAGCAACCATTTCAGATTACTTG
CACCAACATGAAATAACAAAATCACTTGTGACTAAGGAGTTGGTTTGGTTCCTGGCTTCTGCTTTGCTGGCTCTACCTGTGTTTATTATGTACAGGCTTC
TAGTAGATACCTTCTGGTAGTTTGTTTTACTTTCGTTAGCCAATATAATTCTAATTATCAACGCTGCGACCTTGCGTGAACTGATAGCATAATTGCCTTG
AAACCTCTTGTTGACACAGCACGAAGAAGCAGAAGAGATCGCCTCTTAATGGTAACGGAAACAATGGCAATAGGAGACACAAGCGCCGACATGCTGAGAA
GTAAACTATCGTCGGCTGCCATGTAGGGTTGCAGAAATCAGAGCATGTCCTTCCCTGATGAGGCTGCGCTCCTGTTCATGGTAGAAGGATGGAACGCTGT
ACACCACCAGATTTTTTCGTTTTCCTTTTGCCCCCTATTGTACGGACTCTAGTTTCAGCAGCGGCCTTATGTATCTGCATCTTGCCGAGGTTTAATATGG
GCTTAAACCTCGGCGTTTGTTAATTGTTTATTGTAACTTTGTTGATACGCTTGAGTTTGTTTGCAGCGTGCTTTGCTAGTTTTTGTTCTCGCTCATCGGC
ATCCTAACTATACGAGATACGGTTGTTCTACAATTTATGTAATTAAAATCCGTACGTGCTAAAAAAAAAA
page-top