Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig58
Contig Information
Length 343 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd8o16    rwhvd8o16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit type II LHCI [Lolium temulentum]
Score 194
Evalue 9.43793e-14
Total Hit Count 212
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig58
CCTCGTGCCGAATTCGGCACGAGGCGTGGTTCCAGGCCGAGTACACCGGCACCGGCCCCATCGACAACCTCTTCGCTCACCTCGCCGACCCCGGCCACGC
CACCATCTTCCGGGCCTTTGCCCCCAAGTAAGGAACACGGTGGGAGTTAGCAACTAATCCGAGGAGTGTGCTACCACGGGGAAGAAGATCGCTGGTGGAA
CTTGATTTTTTTCTTTCCTGGGAAGTAGACCGTGGATGATGGTATGTAATTGTGGAGCAATGCATGCTTGTTGGATGTGTACTTGTACCCCGGTGTTGTA
ACCGATGTAAAGAATGAATACCCTTTTGAACCTAAAAAAAAAA
page-top