Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig57
Contig Information
Length 1108 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd13a23    rwhvd13a23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0169700 [Oryza sativa (japonica cultivar-group)] >gi|77553136|gb|ABA95932.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113648772|dbj|BAF29284.1| Os12g0169700 [Oryza sativa (japonica cultivar-group)] >gi|125535918|gb|EAY82406.1| hypothetical protein OsI_37621 [Oryza sativa Indica Group] >gi|125578641|gb|EAZ19787.1| hypothetical protein OsJ_033996 [Oryza sativa (japonica cultivar-group)] >gi|215737384|dbj|BAG96313.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1290
Evalue 4.43439e-140
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig57
TCTTCTGGCTCATATCTCCCCTTCCCCTCCCCTCCTCGTTCCCCTCAGACGCGATTAAACCCCACCTCGCCTAAGGCTGCCGGCGGCGAGCCCCGACCGG
AGCAGGGATCGAGCGAGCAGAAGGGGGAAAGACATGGGGACCCTCGGGCGCGCGATCTACACGGTGGGCAAGTGGATCCGTGGAACGGGGCAGGCCATGG
ACCGCCTCGGATCCACCATCCAGGGCGGCCTCCGCGCCGAGGAGCAGGTGTCAAGGCATCGTACAGTCATGAGCATATTTGATAAGGAGCCAAGGATCAA
CAAAGATGTTTTTGTTGCTCCCAGTGCATCTGTCATTGGTGATGTTGAGATTGGACATGGATCATCGATCTGGTATGGCTCCATTTTGAGAGGTGATGTC
AACAGTATTCGTATTGGATCTGGATCAAATATACAAGACAACTCCCTTGTACATGTTGCAAAGACTAACATTAGCGGGAAGGTCCTTCCGACAATCATTG
GAAGCAACGTTACAGTAGGTCATAGTGCTGTTTTACATGCATGCACCATTGAGGATGAAGCTTTTGTTGGTATGGGCGCCACTTTGCTTGACGGAGTGGT
TGTTGAAAAGCACAGCATGGTTGGCGCCGGATCTCTTGTCAAGCAGAATACAAGGATTCCTTCTGGGGAGGTCTGGGTTGGTAATCCTGCCAAGTTCCTA
AGGAAGCTGACAGAGGAGGAGATCACATTCATCGCCCAATCGGCAGCCAACTACATCAACTTAGCTCATGTTCATGCCACTGAGAATTCCAAGAGCTTCG
ACGAGATTGAGCTCGAGAAGAAGCTGAGGAAGAAGTTTGCTCACAAAGACGAGGAGTACGACTCAATGCTCGGAGTGGTCCGTGAGATCCCGCCGCAGCT
CATCCTCCCCGACAACATACTCCCAGACAAAGCACCGAAAGCAGCTGTCGCTCACTGAGATCAAGCCCCTCGTAGGGATGCTTTGATTTTGATAAGTGGC
GACCTGGAACATTTGACGTATGTTTTGGTCTTGTTCTCTGTTTTTTCATGCCCAATAAGATTTGGGTCGAGCGCTGTTGTAGGATCGACCGCATACAGTA
CCTCTCTT
page-top