Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig56
Contig Information
Length 621 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd8p08    rwhvd8p08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit thioredoxin H-type [Zea mays]
Score 327
Evalue 7.11479e-29
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig56
GAGGAGGGGAAGGTGATCGCGATCCACAGCCAGGAGCAGTGGAGCACCAAGATCGAGGAGGCTGGCAGCAGCACGAATCTGGTGGTGATCGACTTCACTG
CAACATGGTGCGGACCATGCCGCTTCATTTCTCCAATCTTAGATGAGATTGCCAAGAAGCTTCCAAATGTTATGTTCCTGAAGGTGGATGTTGATGAAAT
GAAGTCAATTGCCGAGGAGTTCAGTGTTGAGGCTATGCCGACGTTTGTGCTCATGAAGGAAGGAAAGGTGGTGGACAAGGTTGTGGGAGCTGCCAAGGAG
GAGCTGAGCGGGAAGATTGCCAAGCACAGTGCAACTGCATGCGCTAAATAAAATGGTCCTTCAACTCTAAATTCGAGAATAAGATGTGTGTCAGCCGCTG
CTTGCTACTACCGCTCAACTCATGGATAAGCTGGCACCGGTGCAGATAGAGTACGTAATGTAATGTTAAACCCTGTTAATCGCGCGGCGCACACGTACTG
GCGACAAACTGTATGTGATGATAACATCGGTCCACGAATAAAAAAGAAACCCCGTGTGCCCAAGGTTCAACCGTGTGCAATGCAACGGANAATTCNTCNC
CTGCNATACNGAAAAAAAAAA
page-top