Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig55
Contig Information
Length 567 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd13a11    rwhvd13a11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11300 [Oryza sativa Indica Group]
Score 528
Evalue 2.76778e-52
Total Hit Count 29
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig55
CGGCACGAGGGTCGTGACGGCAGATCTTGCCGCGGTGTCTGCTGACCCAATGTCGCTGCCGCTCTTGTTGCACTCGCAGAGGCCCTACGGCGACATCTTC
ACCGTTGATATCGACCCGGATGACATGGAGAAGAACCAGGATGTGGAGGAGTTTGCCCGAGTCACGCATAGCAGGTACGAGAACGCCACTCCTGACTGGA
CCGTGTTCTCAACTCATGACCCGCATGCGCAGTGGAACCTCCTGGTCATGGAGGAGGAGTACACCCCGGCGTGCCCGTATGCGCATCATGATGGGGGTGA
AAGCTGGCACATGACAGGTCAGATGTGCATCCCGAAAAGGGTCTGTTGATCTTACGCCGCTATGTCGGAATGGCCCGGATAACTGTGCCTGTTTCGCGCT
TGGGCTCATACTGTTGCCTGGATTTATTGCTTGAGATGTATTTGTAATTTCTGTTTGGATTGCTGTCTATTTGGGTTGGTGTTGAGGTGATTTGCCCGGA
CCATTTGCATTCTACACATTTCATCTTGCTGTAATATATAAGGCTTCANAGTTTTATAAAAAAAAAA
page-top