Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig53
Contig Information
Length 547 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd13a04    rwhvd13a04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cyclophilin [Triticum aestivum] >gi|32401384|gb|AAP80861.1| cyclophilin [Triticum aestivum]
Score 497
Evalue 1.00378e-48
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig53
ATTATCCCCAGCTTCATGATCCAAGGAGGCGACTTCACTCTTGGTGATGGAAGGGGTGGTGAATCAATCTACGGCACAAAGTTCGGCGATGAGAACTTCA
AGCTCAAGCACACTGGACCAGGCTACCTTTCCATGGCCAATGCTGGGAGAGATACCAACGGATCCCAGTTCTTCATCACCACTGTAACTACGAGCTGGTT
GGATGGCAAGCACGTCGTGTTCGGCAAGGTGTTGTCTGGAATGGACGTGGTCTACAAGGTCGAGGCCGAGGGCAAGCAGAACGGGACACCAAAGAGCAAA
GTTGTCATTGCTGACAGCGGGGAAGTGCCGCTGTGATGACCTGAAACGGTCTCTGGTGGAAAGCTACGGTGACTAGTTTCCGTTGTAGAAGCGTTATTAT
CCGGACTGTTTTCGTGTACTTCCGTGTGAATTTAGACGGCAAGTTTTTTCCTCTTTACTATAAAAAAGTACAATGACTTGCTTACCCGTGATCTGGCTGG
CAACTTTGAAGGTATCATACACCACCGTTCTGTTGTCAAAAAAAAAA
page-top