Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig52
Contig Information
Length 976 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd8p22    rwhvd8p22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0195500 [Oryza sativa (japonica cultivar-group)] >gi|113531822|dbj|BAF04205.1| Os01g0195500 [Oryza sativa (japonica cultivar-group)]
Score 529
Evalue 4.161e-80
Total Hit Count 250
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig52
GCCGGCCCCGGCGAAGGTGCTCTACTGCGGCGTGTGCGGCCTCCCCGCGGAGTACTGCGAGTTCGGCCCCGACTTCGAGCGCTGCAAGCCGTGGCTCCGC
GCCCACGCGCCCGGCGTCTACCCCGACGAGCTCGTGGCCTCCTCCTCCGGCGGCGACGATAAGGACGTGGGCAAGGTCGGCGAGCGCCTCCAGGGCGTCA
GCATCTCCACCGCCGACGGCTCCACCAAGCGCAGGGGGTGCTTCGGCATCTTCTAAGACTGAAGAGGTGAAGCGACTGCCGGGCGGTAAGCTCAAGAAAA
AGGACAAGCAAGAGGTTATTATTGAGAAGATTGTCCGCAACAAGCGCAAGTGTGTTACTGTGGTGAAAGGCCTGGATTTGTTTGGTGTAAAGCTGAGTGA
TGCTTCAAAGAAGCTTGGAAAGAAGTTTGCTACTGGAGCTTCGGTTGTCAAGGGCCCAACTGAGAAGGAGCAAATTGATGTCCAAGGAGACATATCATAT
GATGTTGTGGACTTCATTACAGCTACATGGCCTGATGTTCCTGAATCCGCCGTATATTTCATAGAAGATGGAAGGAAGGTTGCTGCTGCTTGATTACATA
TGGTTTACAAGGCATACACCAGTGGAGTTACAAATATGATAGAAATATAAGGCAAGAGACGGCCGTTAAGGCATGCCTGTCACATGGGTTCTTAATCCTT
ACTCCCAAGACACAACCCGCTCCATTTTGACTTGTGGGTCAGTTCACAAGTGGTGTTTTAACTACCGCTGGCACGTCGCCTTCGTGTATCATCTTTTATT
TGATAGTCGAGTTCCTCCTGCAAGGCGAGTATGACATCCATATGTGATTTATATGGTTTAATGTGCTTTTGAATCCTAGTTTCAAAACAATTCAGTACCA
ACTATCCGTGGACCTGCAGAGATAAGTGCAGATTAGTAGTGCTCCAGTCTCGTCTGCTTTCATAGGAACCAGTCTG
page-top