Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig50
Contig Information
Length 1293 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9a03    rwhvd9a03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit granule-bound starch synthase I [Oryza rufipogon]
Score 110
Evalue 0.00372369
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig50
GATGTTGTGGAGCTGGACGAGGTTTCTGGGCAGTTCATTGACCGCCTGTTCTTCCTGGAGAAGTCCTTTTTCTGCTGGTTACAAATTCCAGGTGATTTAC
TCTGCCAGGCGGCAGCACTCGAAGCACACAGGATCCTGAACCTCAACAACAACCCCTACTTTTCTGGGCCCTAATGTTGCAACGGCCGTGACGGCGTCGA
GGCTCGGGCGTGTGGCCGTCGACGTGGAGCAGTTAGAGGAGGAGCGACTACTACCCCAACGGCAGCCTCTTCTCCCTTGTCCACGTTCGGTTGGTGCCAT
GGCGGAGGGTTGTCTTGTGGTTTGACCGGAGAGGGAGCACACCAAAGAAGCGATCTCGTCCCCATTGGTCAGGTACCCTTCGTCTTTCTCTCGTTCGACC
TCTCCAAGAAAGTTATATAGGTGAGTAAGCTAATTGTGTGTTCCGGGTGTTGTATAGGATACTACGGTTAAAGATTGTTATCATTTATATTGATGTTGCT
GATTATCAAATCAATGGCTGTTATCTAGAGTGCTTCTCCTTCAGATTTGACGTACTATGTCTTCCAGCTTATACTATATATGATGTCTTTCCATGGTTTT
AACTAATTATGGATATGTATCTAATTATGTTATTTTGGCATCAACAAATTACTCACCTAGCATTTATTCTGCTACATGGAAACAATCGGTGCCTATTTCT
TTTTGATCTGAACTCAGATATAATTCTGCTATATGTAAACAATCATTGGTTCTTTCTTTTCTATCTAAACTGAGAAATAACTCTAATCAGTTGTTGTTTT
ATTTACTGTCCAAGTATCATTCTTACCCTAAAACTTGTGCCAAAACTGGTTTTTCTTTCATATGTGCCATAGATTATCCAACCCCATCTGCTTCTGTACA
ATTTTGTTGACTTATCTGGCATTTTTTTGGCCGTGTGGAACCAGCACATCTACATGCGAATCTCCAGGCTATGGTACCAGTGGGGTGGCTTCGATGATGG
CCCTATCAAGAGTATACATGTGCTCTTCTATAGGGAAATCATGCCAACAAGATGGTGCCTAATGAGGTCATAGACATGTTTGTGGACACTTTGCATGAGA
GAAATTTATACAAGTGTGCCAGGATCCATGTGAGGTTCCCTGTAACAATTCTGAGGGCAGTGGAAGGCACGTATACGTTATGGTTCACTAGATCAACAAT
TGTCCATCACCTTGAGGGTGTTCCATTTGGTCATGTCTGTTAACATGCTTAGTTGCTTCTTCTTTATTATGTTAATGCTCCAATAACTTCTCA
page-top