Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig49
Contig Information
Length 1175 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9a14    rwhvd9a14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit NADP-dependent malic enzyme 1 [Triticum aestivum]
Score 1405
Evalue 2.22438e-153
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig49
CCAGTTTGAAGACTTTGCCAATCACAATGCGTTTGATTTGCTTGCGAAATATAGCAAGAGTCATCTTGTTTTCAATGATGATATCCAGGGAACAGCATCT
GTGGTCCTTGCAGGTCTGTTATCTTCGCTGAAGGTTGTTGGTGGAACCCTAGCAGAGCACACCTATTTGTTCCTTGGTGCTGGTGAGGCTGGAACTGGTA
TTGCAGAACTCATTGCTCTTGAGATTTCAAAACAGACAAATGCTCCAATTGAAGAGTGCCGCAAGAAGGTTTTTCTGGTGGATTCGAAGGGTTTGATCGT
TAGTTCCAGAAAAAACTCCCTTCAGCCATTCAAGACATCTTGGGCACATGAGCGCGAACCTGTGACAACCTTGTTAGATGCCATCAAGTCCATCAGACCT
ACGGTGCTGATCGGAACATCTGGAGTAGGCAGGGCTTTCACTAAGGAAGTTATTGAAGCTATGGCTTCTTTCAACGAGAGACCTGTCATCTTCTCATTGT
CAAATCCAACATCGCACTCTGAATGTACTGCTGAAGAAGCATACAAATGGACCCAGGGTCGTGCAGTGTTTGCCAGTGGAAGTCCGTTTGACCCTGTGGA
GTATGATGGAAAGATTCGCGTGCCTGGCCAGGCAAACAATGCTTACATTTTCCCTGGATTTGGCCTTGGTGTTGTGATTTCTGGAGCAATCCGCGTACAT
GAGGACATGCTTCTTGCTGCCTCGGAAACACTAGCTGCACAGGCCACTCAGGAGAACTTCGACAAGGGATCCATCTTTCCACCCTTCACCAACATCAGAA
AGATATCTGCCCTCATTGCTGCTAGCGTGGCTGCAAAAGCCTACGAACTTGGCTTGGCGACTCGCCTGCCGCGGCCGAGAGATCTGGAGAAATATGCGGA
GAGCTGCATGTACACCCCTGTCTACCGCAGCTATCGTTAATGCAGTGGAGATCAATTTTGCAGTAATAAAACGCAAGGTCGCAGGATGCTGCGGCGCTGT
TGTTGTCTGTCGCTGTTCTTGCCGCTGCTGCAAGTCGTATCTGTCTATACATATATGCCGTGTGTGTTGTAACGCTGTGGAAGAAGTTAAGCAAACTGTC
TTGTGTATCAACGTTTGTTATTCGTGTAGGTTGAGTGCAACGAGTGTAATAAGGACACAGAGCTCTAGTCTCAAG
page-top