Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig47
Contig Information
Length 1104 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9b03    rwhvd9b03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0165400 [Oryza sativa (japonica cultivar-group)] >gi|122247496|sp|Q10RB4|BGAL5_ORYSJ RecName: Full=Beta-galactosidase 5; Short=Lactase 5; Flags: Precursor >gi|108706354|gb|ABF94149.1| Beta-galactosidase precursor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113547539|dbj|BAF10982.1| Os03g0165400 [Oryza sativa (japonica cultivar-group)] >gi|215717073|dbj|BAG95436.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1079
Evalue 1.29364e-115
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig47
AGTTCAGTTGAATGGATGCAAGGATCATTGATAGCACAAAACCAAATGCCATTGGCATGGTATAGGGCATACTTTGATACTCCAAGTGGTGATGAACCTC
TGGCTCTGGATATGGGTAGCATGGGTAAGGGACAAATCTGGATAAACGGACAAAGCATTGGACGGTACTCATTAGCATATGCAACTGGGGACTGCAAAGA
TTACAGTTACACTGGGTCATTCCGGGCAACCAAATGTCAAGCAGGTTGCGGTCAGCCGACACAACGCTGGTATCATGTGCCAAAATCCTGGTTGCAGCCA
TCTAGAAATCTGTTAGTTGTTTTCGAGGAACTTGGCGGGGATACTTCGAAGATTTCGCTTGTGAAGAGATCAGTGTCAAGCGTCTGTGCTGATGTATCAG
AGTTTCATCCAAGTATCAAGAACTGGCAGACTGAGAGCTCAGGGGAAGCTAAGCCTGAGTTACACAGGTCGAAGGTGCATCTAAGATGCGCGCCTGGGCA
GTCTATTTCTGCCATCAAATTTGCAAGCTTCGGGACGCCCTCTGGGACTTGCGGAAGTTTCGAGCAAGGGGAGTGCCATTCGACCAAGTCACAGACTGTT
CTTGAGAAATGCATTGGGAAGCAAAGGTGCGCCGTCGCCATCTCCCCCGACAACTTCGGTGGAGACCCCTGCCCGGATGTGATGAAGAGGGTGGCGGTCG
AGGCGGTATGTTCTCCCGGTACATAGGCGACTCTTCCGACTAGACTAATTTAAGGACGGCGCAGCAGCCTTGTGTGTGACCGATCAAGCACATGGGAAGT
GATGTGGGGAGGTGAGAGTTCAACTGTAAAGTACTACCGACTCGATGTAGACGTGGCGCTGGAGGATTAGAATTCCATCTCTAGCATTGTGATTCAGATT
AGGATTGGTGCTCTACCCTGCATCTCCATGAATTGTTCAAAAGCGACCAGCTGGTAATTTGTGGTTGGTCCTAGATGGAGTGTAGGGAGAGTAGAGGCAA
AAGATCGATGCATTCTTTTGCTCGTGTCGTCGCTATGTTTTGGCTGTGTCACTGCCATCTTTCTTGAAGAAGAGAAGATGCTGTATCCCTTACTTTTGAA
ATAC
page-top