Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig45
Contig Information
Length 745 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9p08    rwhvd9p08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Physcomitrella patens subsp. patens] >gi|162663865|gb|EDQ50607.1| predicted protein [Physcomitrella patens subsp. patens]
Score 69
Evalue 0.0777252
Total Hit Count 46
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig45
CATGACGCCCCAGATGCAGGGAGCGGCATCGCTGCATCCGTTCTTTCCATTCTCCATCGCTGCCACGACCAGTGAGATCCGCACGAGGAGGGAGATGCAT
CAGGGAGGTTTCACGCTGCTCACCGACGAAGCCCTCCGACGAGCGGCCAGACCCAGGCGAGGTGGATTTCGTCGGTGAGGCCCTGTTCCCTTCCTCCTCT
TCTGCGCGATGGCGAGGTGGATTTCGTCAGTGAGGTCCTGTTCCCTTCCTCCTCTTCTGCGCGATCTGGCCCAGTGGGTTATTGCCAGGAGTGGTCTTTT
GGGTTTTGCGAGAACGGCGTGTCCAGGACTCCAGGTTAAAACCAGCCGCCCTCCGAGCAAGAGCACCATGTACCTCTACTACGAGGGCATGCCAGGTTTT
CCACAAGCTTAGCCGCGAGTCATACGACTTCCTCCGCAGGAACTGTAACCACTTGTACTACGCTCTGCCATAATCTCCGCATCCCCAAGCTTCCAAGTAA
GGGTAGGAGATTTAGCCTTTGTTCTTCTGATTAGCCACTGAACTAAGGTCTTCTTTATAAAAATTAGTCACTGGACTGTATTTGTAGGCACTGTATGGTG
GCGTTTGACACATCTTAATATCATGATTTACTATAGAAATGGCCACATATCTGTAGTATTTTTTTGTTCCCAAAACCAGAATTGGTCCAACTGTAATTTT
CTTGTTACTTCTCAGAATTGAAGCTTGGTACCGATAAAAAAAAAA
page-top