Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig42
Contig Information
Length 530 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9o22    whvd9p21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Tetraodon nigroviridis]
Score 62
Evalue 2.64143
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig42
TGTGCGGGAGGAACATGGGGCATGATGCCCATGGCCATGCGCCACACTTTGCTGCAAGTCATGCTCACTGAGCCTACCGTATAGCAGCAGCAAAGAGAAT
ACTACGTATTACAATAAATACTACGTACTTCCACTTTCTATTTCTGTTATGAACCACCGTGTATGTGTGGTCCTTGTGGTTGCGGTTACGGTCTCCCGGG
CTCCTCAACTTCGTGGTTGTCCGGCGTAGATTCCTGCCAGCTCCTCGGGGCGGTGAGGTTAGGGTATTCTTGTCGTGCGTGTGCGACGGCGAGATTTGGT
GTCGGGTTCATGGGCTTCAACGGCGATGACTGCGGCTTCAGAGCGGGCACATGTCATTAGGGGCGTGTGCATAAAGACTTCTCAGTTGTCATCGACAAGA
TCGGGCCGGCTCCGGTGTGGACAGTGGTCGTTCGTGGGCCAGCTACCTTCATGTAATCTTTATTGTAAAGGTTCACATGAAGTACAAAGCACCCCAAACA
TAATAAAGATCTACTTTTACAAAAAAAAAA
page-top