Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig41
Contig Information
Length 624 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9b18    rwhvd9b18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216899 [Zea mays] >gi|194696944|gb|ACF82556.1| unknown [Zea mays] >gi|195617290|gb|ACG30475.1| 50S ribosomal protein L31 [Zea mays] >gi|195625392|gb|ACG34526.1| 50S ribosomal protein L31 [Zea mays]
Score 542
Evalue 8.45318e-54
Total Hit Count 416
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig41
GCGCTCTCCCTCTCCACCTCCTTCCTCCTTACCCCGGGCGCCGCCGCCGTCGCGAGAACCGCAAACCGCACCCTCCGCTCCCTCGTCCCCTCCCAGGGGA
TGAGGTGCTCCATGCGGAAGAAGGGGCTGCACCCGGAGATCTTTGAGGACGCGAAGGTGTACTGCAACGGTGAGCTGGTGCTGGTGACGGGGGGCACGAA
GCCGGAGTACTCGGTGGACGTTTGGTCGGGCAACCACCCCTACTACGTCGGCGACTCCTCGGCGCTGGTCGTCATGGACAGCCAGATCGAGAAGTTCCGC
AAGAAGTGGGGGCACGTCAAGGAGTACTGGACCAAGGAGCAGTGGCTGGAGATGCACCCTGACGGCGACCCGGAGTTTGAGCCTGAGGACGACGAGACCC
GCAAATGATGGCTGCCTCTCCTACTCCTCGTCTTCCTGCTGCGTTTCTCTTGCTGTTCACTCCCGAACTCAATTATGCTAGTTTGCGTGGCTTGATTCTC
CCGCTGTACCGTCTTCACGTTGATTGATTTGGTTCACGGGGATTGCATTTGCATTGCCCTCGAGGTGTTCGGGTAATGTTCGCAACGACTCTAGTAATAC
TCCTACTACTTTCCAAAAAAAAAA
page-top