Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig40
Contig Information
Length 1000 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd9o18    rwhvd9o18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_29850 [Oryza sativa Indica Group]
Score 1199
Evalue 1.343e-129
Total Hit Count 310
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig40
TGGTTCTTGACGAGGGACTTGCATCCCCTAGGGAGGAGTACCGGGTGTTCTATGCAGAACGTAGTCCTTGGTGGCTTACTATTAAAGCAAAGGGAGCGCC
AGGGCATGGTGCAAAATTGTATGATGGTAGTGCAATGGAGAATTTAATGAAAAGTGTGGAGGCTCTTCGGAGGTTCAGGACAGCTCAGTTTGATTTGGTT
AAGTCCGGAGAGAAAGCTGAAGGGGACGTTGTATCGGTGAATTTTGCGTACTTGAAGGCTGGGACACCTACACCCACGGGTTTTGTGATGAATCTACAAC
CATCTGAAGCAGAGGTAGGAATTGACATTCGAATCCCTCCTAGTGTTCATACTGAAGCACTAGAGAAGCGTCTTGCTGAAGAATGGGCACCTTCTTCACG
CAACTTGACTTTCGAGTTCAAACAAAAGGGCTCTGTCCTTGACAAGTTAGGGAAGCCAGCCATGACAATTGCTGACAGCTCGAACCCATGGTGGCCTGTG
TTTGAAGAATCTGTGAAGCGAGCTGGTGGCAAACTTGGCAAGCCGGAGATATTTCCGGCTTCTACTGATGCTCGTTATTTCCGGGAAATTGGGATACCAG
CTTTTGGCTTTTCCCCTATGGCGAACACACCAGTACTGCTCCATGATCATAACGAGTTCCTGAGCAAAGATGAGTACCTCAAAGGAATTGGGATATATGA
GTCCATTATAAAGGCGCTGGCCACACATAAAGATGACGGCATCGACGAGGAGTCTAGGGCAGAACTGTGAGGAAAGATGATCTTATCTTGCCACGCCGGG
ATATCTTGCCTCTCAACGTGCAGTCGTAACGCAGAAGAAGGTTTTGGCAAATACATGTTCTGTTTCTGCTCCGGCGGCCAAAGCAAAACCACAGATACGG
TCCTTGTACATCTCTAATAATTTGACCTGAAATAATTCATGATACTGCATCTGTAGTTCCTCCGCATATTGTACGAGTAATGACATCTCTGTATAATAAA
page-top